                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTGGAACTTCAGGAGCGTGAATTCGCGGCCCAGGAACGCGGCTTCACCGCCGTGCGC
CACCAGCGCGAAGTCGGCACCGGCTACTTCGACCTCGTCTCGCAGGCGGCGGGCGGCG
GCCAGAGCAGCACCACCGCGCTCGCCGGCAGCACCGAAGCCGAGCAGTTCGCGCACCA
CTGAgctgacctcagaagcttaaccatgcaaaggagcctcccgttcggggggctttttttcgtgctggacaccggatacccctttcggatgacgccg
cgctgccaggcccccgctctcctgccgccATG

    DR0829 Gene: DR0829     GI: 15805855     BI number: DR0829     GOG: COG2319     Description: WD-repeat family protei            ac           a  c           t  a           t  t            cg            gc           a  a           a  a           g  a           a  g            cg            ta   t        cg        tt c  c      |  c      g  c c  a      c  c       cg a  g       at        cg g  a       gc        cg ta       |  c       tg cg       t  c       cg gc        cg        cg At        gt        gc Gt        At        at Ta        Gc        gt                         tttttcgtgctggacaccggatacccctttcggatgacgccgcgctgccaggcccccgctctcctgccgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2319 FOG: WD40 repeat ... can be seen here     ..................................................................................................................