Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-20.80 kcal/mol
Antiterminator: Size=52 nt.     Delta G=-19.00 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAACTCATTGCCGAGGGCACCGGCGCCACCCGCGAAAGCGTGAGCAAACTCATCGGC
GAAATGCGCGACGACGGGCTGCTGCTCCCCGCCTACCGCTGCCTGACGCTGACCGACG
AGGCCGAGTTGCGGCGGCTGAGCGGCCTGACCGAGCCGAGCTGAgagaagcggggaagacaggcgcc
agggcgaaagctgcggcgcctttttcttgtcattccctccacttgggtagttggctggaactatgcccgacaggagacgccctgcggctgtgagagccag
tcccgcaccttccagacGTG

    DR0835


Gene: DR0835     GI: 15805861     BI number: DR0835     GOG: -------     Description: hypothetical protei


  G
T  A
 CG
 GC
G  G       ga
 CG       A  g
 GC       G  a
 GC        Ta
C  |       Cg
 GT        Gc
 TG       A  g
 TA       G  g
 GC        Cg
A  |       Cg
 GC       G  a
 CG       A  a
|  A      G  g
 CG       C  a
 GC       C  |       aa
 GC       A  |      g  a
A  G       Gc        cg
G  |       Ta        gc
C  |       Cg        gt
A  |       Cg       g  g
G  |      G  |      a  c
C  |       Gc        cg
C  |       Cg        cg
A  |       Gc        gc
G  |      A  |       cg
 TA        Gc        gc
 CG        Ta        gc
 GC        Cg        at
                        ttttcttgtcattccctccacttgggtagttggctggaactatgcccgacaggagacgccctgcggctgtgagagccagtcccgcaccttccagacGTG


    ..................................................................................................................