                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.66 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-10.92 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGACGCCCTGCTGACGCTGATTTTCGATGCCAGCGTGGCGCTGGGCAAGGTCAAGGT
GTACGCCCGCAAGACCATCGGCAAACTCGAACCCATTCTCGACGAAGTGCGCGACCTG
CCCGAGCCCGAACTCGGCGCGGACTTCAGCCAGGGGGCCACCGCTCTGCTTGACGACC
TGCTCGGCTGAgttcttgctgggctgaacatctggtcggccaagcgccctgcggcccggtcctgtctcccttcctgcttttcccctgcgctg
aggcccccgcccagcttcttttcccggaggtcacGTG

    DR0853 Gene: DR0853     GI: 15805879     BI number: DR0853     GOG: COG1100     Description: gliding motility protei   c c  c g  t        c cg       t  c gc       t  c a  |      t  c a  |      t  t cg        cg cg        gc |  c      t  | gc       c  | gc       c  | cg       t  | tg       t  | |  t      c  | gc       c  | gc       c  | |  t      t  | |  g      c  | |  t      t  | t  c      g  | c  t      t  | t  c      c  | a  c      c  |       cc c  c       tg       c  c at        gc        cg at        gt        gc gc        cg        gc |  c      |  a      a  | t  t       cg        gc cg        cg        ta gc        gc        cg gt        gc        gc                         ttcttttcccggaggtcacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1100 GTPase SAR1 and related small G proteins ... can be seen here     ..................................................................................................................