                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.44 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -6.42 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAAGTACTCCAGTCGCGCCTGCTGCGGCCCCAGCTCAGACTCAGTCGCAGCCCCAGG
TAAGTGGCGATCATCCCCACCCCGGCGTACATTACACCGCCAACCCGGTGCACCCCGG
CGTGGTGCCGATTCCGGACAGCGTGGTCGAGGCGAAGGCCCAGGGCACGCCTATCAGC
GAAGACCAGAAGGTCAACCCCAACCTGTCCTGAgactcttttcctgtggcggctccctgcggggggctgctttttt
gtgccgccgttcctgggtcggctgcgcttgcgctttgctaccctgcctccATG

    DR0865 Gene: DR0865     GI: 15805891     BI number: DR0865     GOG: COG0735     Description: ferric uptake regulation protein, putativ            TG           C  A GA        Cg A  A       Ta CG        Gc CG       |  t AT       |  c GC       |  t |  A      |  t |  A      |  t |  C      |  t |  C      T  c |  C      C  c |  C      C  t |  A      A  g |  A       At        gc |  C       Cg       t  g |  C       Cg        cg |  T      |  c       cg A  G       Cg        cg AT        Cg        tg GC       A  c       cg C  |      A  t       gc GC       C  |       gt AT       T  |       cg CG        Gc        gc TA        Gc        gt                         tttttgtgccgccgttcctgggtcggctgcgcttgcgctttgctaccctgcctccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0735 Fe2+/Zn2+ uptake regulation proteins ... can be seen here     ..................................................................................................................