                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-20.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGGAGTCAGCAAAGCCTTTACGCCCCAGCAGGAGCCGACGGAGTGGAAGACAGCTC
CGCTGCGCTGAgggattctctgggctgaagcggtgctctgcgcttcttttgacgtgaaaccagacctcaagcttgctccgattttcagtcgg
agacgagcttttcgagccacagaataaaagtgaaatcccccgttctggacgagggatttcttcttggTGCGAATGCCCAGACTTGA
ACTGGGGACCTCACGCTTATCAGGCGTGCGCTCTAACCAGCTGAGCTACACTCGCgccc
ttcttGTG

    DR0873 --- DR0872 Gene: DR0873     GI: 15805899     BI number: DR0873     GOG: COG2873     Description: O-acetylhomoserine (thiol)-lyase Gene: DR0872     GI: 15805898     BI number: DR0872     GOG: COG2021     Description: homoserine O-acetyltransferase, putativ   t t  c t  a       cc tg       g  a at       a  c gc       g  a cg        cg cg        ta ta       |  a cg       |  t |  a      |  a gc        ta tg        ta ta        ta         t cg        cg       c  g gc        gt        tg at       a  g       ta at       g  a       gc |  t      c  a       cg |  t      a  a      c  a |  c      g  |       cg cg        at        cg ta        gc        cg cg        gc        ta                         tttcttcttggTGCGAATGCCCAGACTTGAACTGGGGACCTCACGCTTATCAGGCGTGCGCTCTAACCAGCTGAGCTACACTCGCgcccttcttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2873 O-acetylhomoserine sulfhydrylase ... can be seen here [E] COG2021 Homoserine acetyltransferase ... can be seen here     ..................................................................................................................