                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-11.73 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGGCTGATCGTTGACGTTGCCGCTCTCGTCGGCGTTCTCGCGCAGGATGTCCTCGGC
GCTCATCTTGTCGTTGAGCAGTTCGCCGGTGGTGCCCTCGTCCACCACTTCGCCAGTT
ACTTCTTGCTCCAACTGCTCGGCGTTCAGGTGCTGTTCGTCGCTTTTGTCGTTGCGGG
TCATgggggcactctaaagcgcaccagggacgcggggctgagccgcaccttgagaatcttccgggcacattcccttgtgcgtcaccgggcgcggcgc
agcggaggcccgcgctatgctgcccgcagATG

    DR0876 --- DR0875 Gene: DR0876     GI: 15805902     BI number: DR0876     GOG: COG0494     Description: hypothetical protein Gene: DR0875     GI: 15805901     BI number: DR0875     GOG: COG0308     Description: zinc metalloprotease, putativ             G           T  C TC       T  T C  G      C  C C  T      T  C C  C      T  A GC       C  A TA       A  C GC       T  T GC        TG TA        GC GC        AT GT       |  C |  T       CG         T C  C       CG       G  G CG        GC        GC GC        CG        AT |  C      T  T       CG |  A      T  T      T  T |  G      C  C      T  T C  T      A  A       GC T  T       CG        CG TA        CG        GT GC        AT        GC AT        CG        CG                         CTTTTGTCGTTGCGGGTCATgggggcactctaaagcgcaccagggacgcggggctgagccgcaccttgagaatcttccgggcacattcccttgtgcgtcaccgggcgcggcgcagcggaggcccgcgctatgctgcccgcagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here [E] COG0308 Aminopeptidase N ... can be seen here     ..................................................................................................................