                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.90 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGATGCTGCGGAACCTCGCCCTGAGCGGTATCAGCGGTGAGCAGGCCGAGCGCGCTTC
CATCAACGGGGCGCTCGCGCTGTACCTCGACTTCATCAACATCTTCCTGTTCCTGCTG
AATATCGGCAACTCGCGCGACTGAgccgctcactctcttccaagccctggcccacgcggtcagggttttttcttggcaggac
acgcagttgaaccacccgtcaggtgagtccacgggggcttgacaaacggcagccgggcgctcagctcagccgtgacggttctgttagatcgcgctgctta
caGTG

    DR0892 --- DR0891 Gene: DR0892     GI: 15805917     BI number: DR0892     GOG: COG0642     Description: sensor histidine kinase Gene: DR0891     GI: 15805916     BI number: DR0891     GOG: COG2197     Description: DNA-binding response regulato   c g  t c  c c  a gc At Gc |  t T  c C  t At Gc         c |  c      a  g C  a      c  c G  a       cg Cg        cg Gc        gt C  c       gc T  c       ta C  t       cg A  g       cg A  |       cg Cg        gt Gc        at Gc        at             tttcttggcaggacacgcagttgaaccacccgtcaggtgagtccacgggggcttgacaaacggcagccgggcgctcagctcagccgtgacggttctgttagatcgcgctgcttacaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here [TK] COG2197 Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain ... can be seen here     ..................................................................................................................