                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:70 nt.    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-13.30 kcal/mol
Antiterminator:    Distance from promoter:49 nt. Size=32 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-tataTT. It has a score value of 78.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatatttttcgtgtcaagcgctataTTACGTGCACCGCCGGAGCCTTGACAGTGCGTGGTCCGGCCA
CCATAAGCTCTCTCCGCCCCGACAGGCGGCCCGCCCCAGAGGGGCGGCTTTTTGAGGA
GAACCATGACCCAGAGTGATGACCAGTTCCAGGGCCAGACCGAGCTTGATCAGCCTGA
GCAGAACCAGACCGATCGGAAGCCGGCCCAGAACGAACCCAATGAGCAGATG

    DR0906 Gene: DR0906     GI: 15805931     BI number: DR0906     GOG: COG0187     Description: DNA gyrase, subunit GA C  C C  A CG CG GC CG CG |  C |  C |  C |  G        G |  C      A  A |  C       CG |  C       CG |  C       CG TA        CG CG        GC TA        CG CG        CG             CTTTTTGAGGAGAACCATGACCCAGAGTGATGACCAGTTCCAGGGCCAGACCGAGCTTGATCAGCCTGAGCAGAACCAGACCGATCGGAAGCCGGCCCAGAACGAACCCAATGAGCAGATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0187 Type IIA topoisomerase (DNA gyrase/topo II, topoisomerase IV), B subunit ... can be seen here     ..................................................................................................................