                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-19.50 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-13.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAATGAACGCCGAGCAGCTGTGGGAAACCACCATGAACCCCGAAACGCGCGTGCTCAA
GCGTGTGAGCATCGACGACCTCATCATCGCCAACGAGATTTTCGACGCGCTGATGGGT
TCGGAAGTCGCGCCGCGCAAGGACTTTATCCGCGAGAACGCCCGCTTCGCTGAAATCA
GCGTCTGAGCCTATCCGCATgaaggcccgcttcccatccggaggcgggctttttcgtgttctccgcgttctgctcggggcagaga
aggccccgaatctttagactctgtccaagcgccggccaaatGTG

    DR0907 Gene: DR0907     GI: 15805932     BI number: DR0907     GOG: COG1278     Description: cold shock protein, CSD famil AA A  T GC TA CG GC CG T  T T  C C  | GT CG         C         t C  A      G  A      a  c CG       C  T      c  c GC        Cg        cg |  C       Ta        cg C  T      A  |       ta A  A       Ta        tg AT        Cg        cg GC        Cg        gc A  |       Gc        cg GC       A  c       cg CG        Gc        cg GC        Tg        gc                         tttttcgtgttctccgcgttctgctcggggcagagaaggccccgaatctttagactctgtccaagcgccggccaaatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1278 Cold shock proteins ... can be seen here     ..................................................................................................................