                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-16.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTGCCCGGTCTCGCGGGTGAGCCGAATTTTCTGCCTGGGCTTAGTGCCTCCAGGCC
TGCCGCCTTGCTTTTTGCCGCCTGTCATCGGCTTTCCGTTTATCACagcgcagacgcccagacgcg
ggggccacgccgcagtcgcccagcctcttgacagggaatcatgagcgccctatactttcctgtcgccaaccaggatgggttggacaggggttctttgccg
gaacgtgaatcacaagtatacatggcaacaataggtcttttttccgaggagcgcaggcgagagccggcggtcccagTTG

    DR0912 Gene: DR0912     GI: 15805937     BI number: DR0912     GOG: COG0085     Description: DNA-directed RNA polymerase, beta subuni cg c  c g  a cg at c  c cg gc         g gc       c  c       ga gc       g  c      g  t g  a      a  c      a  g g  |       gt        cg cg        ta        cg gc        at        at c  c      c  a       at at       t  c       cg gc        at        cg at        at       g  | |  t       gt       c  | |  g       gc        ta |  a       gc        gc |  c       at        ta |  a       cg        cg cg        at        cg cg        gc        tg cg        tg        tg                         ttctttgccggaacgtgaatcacaagtatacatggcaacaataggtcttttttccgaggagcgcaggcgagagccggcggtcccagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0085 DNA-directed RNA polymerase, beta subunit/140 kD subunit ... can be seen here     ..................................................................................................................