                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:129 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=29 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

acctctgacctgggccagcggttttctacgggttccgtctgttccgttgacaaactgggaaagcgccagtttgccaactgtacgtccggaacccgttttt
ctccttctcgctttgcccagattgaatcacttcgtgggcgattcaatcggagttgggcccagaggtttttttccgcgccggagcatgggaaaatcaaggc
tgaagaggctgcccccgccgccgcggtccggcgcagtaagggttgagcaaggccccaggcgtcatgctgttcctgcccgtcttttcaggaggctctattc
ATG

    DR0937 --- DR0938 --- DR0939 --- DR0940 Gene: DR0937     GI: 15805961     BI number: DR0937     GOG: COG0457     Description: tetratricopeptide repeat family protein Gene: DR0938     GI: 15805962     BI number: DR0938     GOG: COG3147     Description: hypothetical protein Gene: DR0939     GI: 15805963     BI number: DR0939     GOG: COG2344     Description: conserved hypothetical protein Gene: DR0940     GI: 15805964     BI number: DR0940     GOG: -------     Description: hypothetical protei             t           a  c           a  g            cg            ta            tg   g        at c  t       gt t  g      |  g tg       |  g cg        cg a  c       gc cg        gc ta        gc at        ta at       g  | gc        cg ta        ta ta        tg at        cg gc        at             ttttttccgcgccggagcatgggaaaatcaaggctgaagaggctgcccccgccgccgcggtccggcgcagtaagggttgagcaaggccccaggcgtcatgctgttcctgcccgtcttttcaggaggctctattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0457 FOG: TPR repeat ... can be seen here [S] COG3147 Uncharacterized protein conserved in bacteria ... can be seen here [R] COG2344 AT-rich DNA-binding protein ... can be seen here     ..................................................................................................................