                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-12.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGACATTCGAATTGCTAACGGGCAGCCGGTCCAGCACCAAATCTACTTCGCCAGTG
GCCTGGGCGCCCGCGCTGCCGCCAAAGGCGCCAATGTGACGCGGGTGGTGGACCTGGA
ATTCTATGGCTTCAGCGCCAACAACGTTCCTTTTACCCGCAAAGTCACGGGCATCGTC
AGTCAGGGAAGCTACGTCGTCAAGACGAACTGAgcgctcacgatcttaagaaaaggccccctgtcgtggggctttt
tgttttggtttcagaggcataacttttttagacaactcgtctaactttacTTG

    DR0941 --- DR0942 Gene: DR0941     GI: 15805965     BI number: DR0941     GOG: COG0133     Description: tryptophan synthase, beta subunit Gene: DR0942     GI: 15805966     BI number: DR0942     GOG: COG0159     Description: tryptophan synthase, alpha subuni            cg           g  c            At            Gc            Ta           C  |           A  |           A  |            Gc            Cg           |  a            At AA        Gc         t C  G       At       g  c TA        At       t  g GC       |  a      c  t CG       |  a       cg TA        Cg        cg |  A       Ta        cg G  C      |  a       cg C  T      |  a       gc A  G      G  a       gt TA        Cg        at Cg        Tg        at Gc        Gc        at                         tgttttggtttcagaggcataacttttttagacaactcgtctaactttacTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0133 Tryptophan synthase beta chain ... can be seen here [E] COG0159 Tryptophan synthase alpha chain ... can be seen here     ..................................................................................................................