                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-15.00 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGAACAAGCCCCTGGTGCCCTACGAGCCGACCACCCTGGGCGAGTTCGTGTCGCTCG
GCGGCCTGATGGCGGTGGGCTGGATGAAGCTCCCCTGGAACCAGAAGCTCGCCATCAC
CGGCGGCATTGCCCACGTGATGAAGCGCGCCTCCGAGTGGAAGTGGCGCTCCAGCGTC
GACTGAgcccaacgtctcagcttcccggtcccttgagggccgggtttttttggcttattgcccaaagggtaaagtctgcgccaaaagatggatgac
cgctgatggttacaacgggcagagtaaggcATG

    DR0949 --- DR0948 Gene: DR0949     GI: 15805973     BI number: DR0949     GOG: -------     Description: hypothetical protein Gene: DR0948     GI: 15805972     BI number: DR0948     GOG: COG0526     Description: hypothetical protei   g c  t a  c a  t c  c c  a cg         t gc       t  g At       c  a |  t       cg |  c       cg |  c       tg Gc        gc Tg        gc Cg        cg At        cg Gc        cg             tttttttggcttattgcccaaagggtaaagtctgcgccaaaagatggatgaccgctgatggttacaacgggcagagtaaggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OC] COG0526 Thiol-disulfide isomerase and thioredoxins ... can be seen here     ..................................................................................................................