                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGGCCGACGCCACCTACGTCGCGGTCGTCAACAAGCTCAGCAACCCCGCCTGGAAG
TTCTACGACTGGCTGATTCTGGCCCTCGCCCTGCTGCACGGGGCCAACGGCGCGCGCT
ACTCCATCGAGGACTACGTGCGGACCCGGCCTGACCGTGCCTGGATCAAGGGCACCTT
CTACACCGTGATCGCCCTGCTGTTTGCTTTCGGCACAGTGGGTCTCTTTTCCCTCTGA
gccccgctggcgacgttgccggctgaggcgacattcagagcaccacatcttctgagagaggaacattcATG

    DR0952 Gene: DR0952     GI: 15805976     BI number: DR0952     GOG: COG1053     Description: succinate dehydrogenase, flavoprotein subuni AC G  C T  G C  T CG GC GC C  T CG        AC CG       C  C |  A      A  G AT       T  T GC        CG |  A       TA         T |  A      T  T      T  C |  G      C  C      T  G G  G      C  |       CG CG       A  |       GC GC        CG       T  | TA        GC       T  | GC        GC        TA C  |       GC        GC A  |       AT        TA T  |      |  G       CG C  |      A  C       GT A  |      C  T      T  | GC        TG        CG GT        AT        CG AT        GT        CG GC        GT        GT                         CTCTTTTCCCTCTGAgccccgctggcgacgttgccggctgaggcgacattcagagcaccacatcttctgagagaggaacattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1053 Succinate dehydrogenase/fumarate reductase, flavoprotein subunit ... can be seen here     ..................................................................................................................