                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:213 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACGAGGCCGAATTCGGACACCAGTTCGTTGAGGCGGCTCATGTTCGCCACtgggtcagccg
tagggtcggcccctgacggcttttttgcatgggggtggtcacaggaaacatgccgggtagtctagcgccccggttccacccttctcgggcatggcaaacg
aaaggtcagcaggccgcttatcccgcgccccccacaagccgcgccgggaatttgtgtcatctgcgcggcgatacgacccgcgctgggaggccactgcccg
catgtttggtgtttctggacgggtaacgagcggcccttGTG

    DR0977 Gene: DR0977     GI: 15806001     BI number: DR0977     GOG: COG1866     Description: phosphoenolpyruvate carboxykinas             G           C  C           T  C            TA            GC           T  |            At            Cg GA        Tg T  G       Cg TG        Gt GC        Gc CG       |  a        g TG        Cg       c  g GC        Gc       t  c T  T       Gc        gc GC       |  g       gc tA       |  t       gc t  T      |  a       at c  G      A  g      |  g c  T      G  g       ta c  |      T  g       gc gT       T  t       cg gC        Gc        cg cG        Cg        gc gC        Tg        at                         tttttgcatgggggtggtcacaggaaacatgccgggtagtctagcgccccggttccacccttctcgggcatggcaaacgaaaggtcagcaggccgcttatcccgcgccccccacaagccgcgccgggaatttgtgtcatctgcgcggcgatacgacccgcgctgggaggccactgcccgcatgtttggtgtttctggacgggtaacgagcggcccttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1866 Phosphoenolpyruvate carboxykinase (ATP) ... can be seen here     ..................................................................................................................