                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-22.50 kcal/mol

                                                                        Nomenclature/Definitions

CGGCGTGACCTACAACGTGGCGCCGCAGCGTGGGTTGCAAAAGGTCCGGGCCATTTTC
CTGCGTGTGCGCCCGACGACCGACCTCGTGCTGAGCGGCGTCTACGACAATGGCCGCT
GGAACACCGCGACCACTGAGTACCTGACCCCTTACGCCTACGCCGACCGCGACGTGCA
GGAAACTTACTTGTATATCCGCTGAgccgcgcctgagcgctgcgctgcccctgacctcgccgcttgcctgcggggtcagggc
tttttgatgcaggctttcgcctatgctgaaaggcaggagacaccATG

    DR1022 --- DR1023 --- DR1024 --- DR1025 Gene: DR1022     GI: 15806045     BI number: DR1022     GOG: COG1694     Description: conserved hypothetical protein Gene: DR1023     GI: 15806046     BI number: DR1023     GOG: -------     Description: hypothetical protein Gene: DR1024     GI: 15806047     BI number: DR1024     GOG: NOG06942     Description: conserved hypothetical protein Gene: DR1025     GI: 15806048     BI number: DR1025     GOG: COG0494     Description: MutT/nudix family protei            t          t  g          c  c          g  c          c  t           cg           gc           cg           tg           cg           cg           at           gc           ta           cg           cg           cg             ctttttgatgcaggctttcgcctatgctgaaaggcaggagacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1694 Predicted pyrophosphatase ... can be seen here [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here     ..................................................................................................................