                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:159 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-14.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCGCTGGGGCTGGATTTTCAGCGGCCTACCGGCGGATATTTCATCTGGGTGACGCT
GCCCGCTGGCGTGTCGGCCACCGAACTGTTGCCCCGCGCCCTCGACCACGGCGTGCGC
TTTCAGCCCGGTCCTCTCTTTTCTCCGAACGGCACCCAGACCGACAAAGCGCGGCTGT
GCTTCGCCTTCTATGAGGAAGCAGAATTGGTGGAAGGCGTGCGGCGGCTGGGCGAAGT
GTTGCGGCAAGTCAGATAAtgtcctccccgctctttgtcctcgcctctctgtctctgaaggagcccctATG

    DR1031 --- DR1032 --- DR1033 Gene: DR1031     GI: 15806052     BI number: DR1031     GOG: COG1304     Description: (S)-2-hydroxy-acid oxidase Gene: DR1032     GI: 15806053     BI number: DR1032     GOG: COG0428     Description: gufA protein Gene: DR1033     GI: 15806054     BI number: DR1033     GOG: -------     Description: hypothetical protei AA G  C C  T                  C CG                 G  T AT                 C  T C  T                G  T CG         A       T  C GC       G  C      G  A GC       C  C       CG C  C      T  A       GC T  |      C  C       GC GC        CG       C  C TG        CG       A  | GC        GC        CG CG        CG        CG GC        GT        AT GC        CG        GC                         CTCTCTTTTCTCCGAACGGCACCCAGACCGACAAAGCGCGGCTGTGCTTCGCCTTCTATGAGGAAGCAGAATTGGTGGAAGGCGTGCGGCGGCTGGGCGAAGTGTTGCGGCAAGTCAGATAAtgtcctccccgctctttgtcctcgcctctctgtctctgaaggagcccctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1304 L-lactate dehydrogenase (FMN-dependent) and related alpha-hydroxy acid dehydrogenases ... can be seen here [P] COG0428 Predicted divalent heavy-metal cations transporter ... can be seen here     ..................................................................................................................