                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agcgcaggtctttacgttctgagcgaaacgcagggcagcattcacggcctatgctcgggcttccgctccccagacggggccagctccagcctgagcagcc
cgcccggacaccctgagtagaccaattctgagccgtccaagaaaaattgccgggttattgcaaaagtcggcatttattctaaggaaagggcaattttcgg
caacagaaattgttgacagcagggctcaaattgcattgacttttcctaaaggcatctttaaaatcgggccacctcagaaccaacgtgcggacacgggtcc
GTG

    DR1038 Gene: DR1038     GI: 15806059     BI number: DR1038     GOG: COG0683     Description: branched-chain amino acid ABC transporter, periplasmic amino acid-binding protei cg c  t g  c a  c g  a ta cg ta ta a  a a  a        g c  a      t  c c  |      t  a a  |      a  a gt        ta at        ta tg       g  g gc        gt a  |       gc gc        cg tg        cg cg        gc cg        ta             tttattctaaggaaagggcaattttcggcaacagaaattgttgacagcagggctcaaattgcattgacttttcctaaaggcatctttaaaatcgggccacctcagaaccaacgtgcggacacgggtccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0683 ABC-type branched-chain amino acid transport systems, periplasmic component ... can be seen here     ..................................................................................................................