                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-34.80 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -9.41 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGACTCCATCGCGGCGTACAAACTCAAACCCGAATCGCTGGAGGGCTACACCGAGG
TCTTCAAATACGGGATGCCCCCGCACGGCGGCTTCGCCATCGGCGCCGAGCGACTGAC
CGCCAAGCTGCTCGGCATCGCCAACGTGCGCTATGCCCGCGCTTTCCCGCGTGACCGG
CACCGGCTGACGCCCTGAatgatcattaaaaaccgggagagccgtggcatacagcctgcggctctcccggtttttgtggactcagtg
gtcgagggtatcggtccctagcgccgagtacgcggggcaGTG

    DR1054 --- DR1053 Gene: DR1054     GI: 15806074     BI number: DR1054     GOG: -------     Description: hypothetical protein Gene: DR1053     GI: 15806073     BI number: DR1053     GOG: COG1073     Description: hydrolase, putativ TC T  C T  C CG         a GC       c  t        a CG       t  t      t  c GT       a  a      a  a CG       g  a       cg |  A      t  a       gc |  C      a  a       gc |  C      A  a      |  t CG       G  c       tg CG       T  c       gc GC        Cg        cg TA        Cg        cg |  C       Cg        gc A  C      G  a       at TG       C  g       gc CG       A  |       at GC       G  |       gc C  T       Ta        gc G  G       Cg        gc TA        Gc        cg GC        Gc        cg CG        Cg        at                         ttttgtggactcagtggtcgagggtatcggtccctagcgccgagtacgcggggcaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1073 Hydrolases of the alpha/beta superfamily ... can be seen here     ..................................................................................................................