                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-13.00 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-14.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAACTTCGGGTATGTGCTCGTCTTCGGCAGCGCGGCGCTGTTTTTCCTGCTCGGCGTG
GTGCTGGTCCGCAACGTACCGGAGGTGCGGAAGGCGGGGTGAgggagtccgcaaaccaaattttttcct
cactcccccctgcctagccgccccctttgaccccgctgcgctgcggcggctacactctgcaccatgttcgcggcactgaacaacgacaacgacgattccc
gctaggggacgcctcgtcgtatggccgcgcccccgcccaccccggcgggggtttttcgttcaaggagagactcATG

    DR1055 Gene: DR1055     GI: 15806075     BI number: DR1055     GOG: COG0017     Description: aspartyl-tRNA synthetase, non-discriminatin            ta           g  t ct        cg g  a       tg cg        gc cg       c  c cg       t  | tg       c  | ta        cg |  c       gc        cc |  g       cg       a  c |  c      a  |      c  c |  c       gc        cg at        gc        cg gc        gc        gc cg        gc        cg at       a  c       cg gc       t  |       cg cg        cg        cg at        gc        cg                         tttttcgttcaaggagagactcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0017 Aspartyl/asparaginyl-tRNA synthetases ... can be seen here     ..................................................................................................................