                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=20 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCATGGAAGTGCTGCACCAGGGCCTCGGGGACGACAAATACCGCCCGTCTCCCCTGCT
CCGCAAGATGGTGCAGGCGGGGCTGCTCGGGCGCAAGAGCGGCGAGGGCTTTTACAAG
TACTGAgccccggctgcgttcgagctgcctggaaagggtccgcctcctcccctgggggcggcttttttgtgcctgccactcgcctggcacccagcg
cagatgagacggacacaaatgtcagacccatgaccgtctaaaggctccatcaaggacaagcggcggcgcagccgtcaaactgcggagcATG

    DR1067 Gene: DR1067     GI: 15806087     BI number: DR1067     GOG: -------     Description: hypothetical protei            cc cc       c  c t  g      t  t gc        cg gc        cg gt        tg a  c       cg a  c       cg at        gc gc        cg gc        cg             cttttttgtgcctgccactcgcctggcacccagcgcagatgagacggacacaaatgtcagacccatgaccgtctaaaggctccatcaaggacaagcggcggcgcagccgtcaaactgcggagcATG     ..................................................................................................................