                                                                        Gene putatively regulated by attenuation in D_radiodurans_1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-25.60 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-19.30 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-19.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agccaaagcattttttgaccctctcaccttgcgggactcgcagagctgcgaagcagagagggccttgcgccgcaaggggtgactcgtagagctgcttgca
gagggggcccccagaccaacttttttccctcccacccctccgccattcggcctatcgccctcccgcccacttccctctatcttcccctcatgaccccgac
cttccccgcacagagctggtggcccgcttagccgggtgatttctcctgtgcctgaccgtcaggccgcgcccggacccgtttccggcgcggcctttttctg
TTG

    DR1093 Gene: DR1093     GI: 15806113     BI number: DR1093     GOG: COG0180     Description: tryptophanyl-tRNA synthetas             c           c  g           a  t ta        gc t  g       ta c  c       cg gc        cg cg        gc cg       t  | cg        gc        cg gt        tg       c  t g  g      c  |      c  t ta       c  |       at gt       t  |       gc gt       c  |       gc t  t      t  |      c  | c  |      t  |       cg gc       t  |       cg at       a  |       gc |  c       gc        cg gc        tg        gc at        gc        cg cg        gc        cg at        gc        gc cg        cg        gc gc        cg        at                         ttttctgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0180 Tryptophanyl-tRNA synthetase ... can be seen here     ..................................................................................................................