                                                                        Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACCCGCGAGCAGCTCGAGGCCTACGCCGCCGAGCACGACCTGCCGGTCAACCCGCTG
TACTTCGACGGCTTTCTGAGCATCGGCTGCTGGCCCTGCACCCGCGCCGTGAAACCCG
GCGAAGATGCCCGCGCCGGACGCTGGGCAGGCAAAGGCAAGACCGAATGCGGACTGTG
GCAGGGCGAGAACAAGTTGTAAgggccccggctttcagaggcctttctttttcactgatcaattgacctttcccatcaactatc
aaccctcgatcagcttcccctgaccatcaacggagaccccgcATG

    DRA0016 Gene: DRA0016     GI: 15807688     BI number: DRA0016     GOG: COG2046     Description: sulfate adenylyltransferas   A A  G C  A GC GC |  G A  A A  A AT CG GC |  G |  G |  A GC         C AT       A  A CG       A  A GT       G  G G  |       AT G  |       GT TG        CG        tt CG        GT       c  t GC       |  A      g  c C  A      G  A      g  a A  |      G  g      c  g G  |      A  g      c  a G  |       Cg        cg CG        Gc        cg CG        Gc        gc G  |      T  c       gc CG        Gc        gt GC        Tg        At CG        Cg        At                         ctttttcactgatcaattgacctttcccatcaactatcaaccctcgatcagcttcccctgaccatcaacggagaccccgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2046 ATP sulfurylase (sulfate adenylyltransferase) ... can be seen here     ..................................................................................................................