                                                                        Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-26.70 kcal/mol
Antiterminator: Size=60 nt.     Delta G=-23.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACTGGGCATCCGCATTCTGAAGTTCGAGCACACCTTCTATTGCCAGAGCTGCGGCCA
ATTGGTCAGCCCCCGCACCTGCCCGCACGACTCCTCGCACCACCTCGTACTGAGCGGC
ACCAAAGTGCGCGAGAAGCTGCGTGCCGGGGAGAACCTGCCCCCTGAGTTCACCCGCC
CCGAAGTGGCCGAGGTGCTGAGGAAGGCCTATACCCGTTAAagtcctggccctcgccgcgtcctttccgc
aacccggcgggggacgcggcttcttttcaggccggtgcgggcgcatcatcctccccATG

    DRA0017 Gene: DRA0017     GI: 15807689     BI number: DRA0017     GOG: COG2050     Description: conserved hypothetical protei TA A  C T  C C  C CG GT GT |  A |  A |  a A  g At Gc Gc At        cc G  |      a  c Tg       a  g Cg        cg Gc        gc T  |       cg Gc        cg Gc       t  | At       t  | Gc        tg C  |       cg Cg        cg Gc        ta Gc        gc Tg        cg Gc        gc A  g       cg At        cg Gc        gc             ttcttttcaggccggtgcgggcgcatcatcctccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG2050 Uncharacterized protein, possibly involved in aromatic compounds catabolism ... can be seen here     ..................................................................................................................