                                                                        Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-25.20 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-18.40 kcal/mol
Anti-antiterminator:   Size=67 nt.     Delta G=-25.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTACCGCCCGCTCAAGACGCCCACGCTGGTGCTGTACGACCAAGACGGCTTCGTTT
CGTTTGACCGCCTGCCGCTGTTTGCCCAGCAGCCGGGCGTGCGGGCCGCGCGTATCGC
CGGTACCGACGGCCTGCCGCAGTGGGAAAAGCTGCCCGAGGTCAGGGCCGCCCTCGAC
GCCTTCTGGCAGGAGCAGTAAcatccgcttcaccgggcgggagcgttcccccagaagaaggggcgctcccgccgtttgttttctt
tcttgcccggcccccgcgcgccctgaccccccgaggaccctATG

    DRA0061 Gene: DRA0061     GI: 15807729     BI number: DRA0061     GOG: COG0477     Description: drug transport protein, putativ CC C  T GC CG |  A |  C CG GC GC |  T |  T       ac GC       c  c AT       t  g CG        tg TG        cg GC        gc G  A       cg A  |       cg G  |       tg        aa CG       a  a      g  g CG       c  |      a  a |  A      A  |      c  a CG       A  |       cg GC        Tg        cg TA        Gc        cg CG       A  |       cg GT        Cg       t  | A  A       Gt       t  | A  A       At        gc A  c       Gc        cg A  a       Gc        gc Gt       A  c       at Gc       C  |       gc Gc        Gc        gc Tg        Gc        gc Gc        Ta        cg At        Cg        gc                         cgtttgttttctttcttgcccggcccccgcgcgccctgaccccccgaggaccctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................