Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -9.94 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTTGGCGGCAGGGGCGGCTTTGGCGGCGGGAGCAGCCTTTTTGGCAGGGGCCTTGGT
AGACTTTTTCGTCATGGTGAGCAGCATGACATATCTCTTTGCGGCTGTGAAGGGGGGC
AAagggggatagagcccctctgggacgccttcattaaggccagggcctcaaaattcgccgtcaaaacgccgtttccccaggacccgagcagtcagaaaa
gggatagttccgcgccaggcactgtttttttcgctttaggggtaggtttaccgagaatgcgcctcatgcccccctcagcgcggcgGTG

    DRA0064


Gene: DRA0064     GI: 15807732     BI number: DRA0064     GOG: COG1404     Description: serine protease, subtilase famil


            a
          g  g
          c  c
          c  a
           cg
 aa        at
c  a       gc
 ta       |  a
 gc       |  g
 cg       |  a
c  c      g  a
 gc       a  a
 cg       c  a
t  t       cg
t  t       cg
a  t       cg        gc
a  c       ta       c  c
a  c      |  t      g  a
a  c      |  a       cg
c  c      |  g       cg
 ta       t  t      t  c
 cg       t  t       ta
 cg       g  c       gc
|  a      c  c       at
 gc        cg        tg
 gc        gc        at
 gc        cg        gt
                        tttttcgctttaggggtaggtttaccgagaatgcgcctcatgcccccctcagcgcggcgGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[O] COG1404 Subtilisin-like serine proteases ... can be seen here

    ..................................................................................................................