                                                                        Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.54 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACGGCGTGACCATCTACCAGTCCAATAACGTGCCCAACGTGGGCGGCGAGAAGTACA
AGATCATGATGGGCAAGGACTACATCACCTTCGCCGACCAGATCGTGAAGACTGAAAC
CTACCGCCCCGAGCGCAAGTTCGGCACCGGCGTCAAGGGCCTGCACGTCTACGGCGCC
AAGAACCTTCAGCCCAAGGGCTTCGCCGTCGGCACCTTCAACAAGGGCCAGATCAGCA
AGTAAttttccccctggaccgactgagcctccctgaccggggggcttttttcgttccctgaggtgctcATG

    DRA0100 --- DRA0101 --- DRA0102 --- DRA0103 --- DRA0104 --- DRA0105 --- DRA0106 --- DRA0107 --- DRA0108 --- DRA0109 --- DRA0110 --- DRA0111 --- DRA0112 Gene: DRA0100     GI: 15807768     BI number: DRA0100     GOG: -------     Description: hypothetical protein Gene: DRA0101     GI: 15807769     BI number: DRA0101     GOG: -------     Description: hypothetical protein Gene: DRA0102     GI: 15807770     BI number: DRA0102     GOG: -------     Description: hypothetical protein Gene: DRA0103     GI: 15807771     BI number: DRA0103     GOG: -------     Description: hypothetical protein Gene: DRA0104     GI: 15807772     BI number: DRA0104     GOG: -------     Description: hypothetical protein Gene: DRA0105     GI: 15807773     BI number: DRA0105     GOG: -------     Description: hypothetical protein Gene: DRA0106     GI: 15807774     BI number: DRA0106     GOG: -------     Description: hypothetical protein Gene: DRA0107     GI: 15807775     BI number: DRA0107     GOG: -------     Description: hypothetical protein Gene: DRA0108     GI: 15807776     BI number: DRA0108     GOG: COG5280     Description: minor tail protein gp26-related protein Gene: DRA0109     GI: 15807777     BI number: DRA0109     GOG: -------     Description: hypothetical protein Gene: DRA0110     GI: 15807778     BI number: DRA0110     GOG: -------     Description: hypothetical protein Gene: DRA0111     GI: 15807779     BI number: DRA0111     GOG: -------     Description: hypothetical protein Gene: DRA0112     GI: 15807780     BI number: DRA0112     GOG: -------     Description: hypothetical protei AA C  C TA TA CG CG A  | CG GC        cc GC       c  t |  A       cg CG        cg TA        ta GT       t  c |  C      t  c C  A      t  | CG       A  | GC       A  | C  |      T  | TA       G  | TA       A  | CG       A  | |  T      C  | |  A      G  | |  A      A  |        a |  t       Cg       g  c |  t       Ta       t  c |  t      A  |       cg |  t       Gc        cg |  c       At        cg |  c       Cg        tg Gc       |  a       cg Gc        Cg        cg Gc        Gc        gc At        Gc        at                         tttttcgttccctgaggtgctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5280 Phage-related minor tail protein ... can be seen here     ..................................................................................................................