                                                                        Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-13.50 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGTGGGGCTGGGCGAGGCCGACGCCGCCGTGGTCTACCGCAGCGACGTGACGCCCGC
CCTGAAAAACGACGTGCGAGTGGTCGCGCTGCCGACGCGCTTCAACCAGACCGCGAGG
TACCCTATCGGCACGCTCAAGGCGTCGCGCAACGCTGCCGCCGCGCAAGCCTTCATCG
CGTACGTCCGTTCGATCGAAGGCCAGAAGATTCTGCGTAAATGGGGCTTCCAGAGCCC
GCGCTGAggcaggtcagaagcttcggctgatgcttttctggccgaggtgaattaaagtccagaaccgtATG

    DRA0168 Gene: DRA0168     GI: 15807837     BI number: DRA0168     GOG: COG0555     Description: molybdenum ABC transporter, permease protein, putativ             C           C  A            TG         c            TA       t  a   T        CG       g  g C  G       GC       g  a T  C       GC       a  a TG        GC        cg AT       |  G       gc G  A       GC        gt A  A       TG        At A  A      A  C       Gc G  T      A  T       Tg A  G      A  G       Cg CG       T  A       Gc CG       G  g      C  t G  G       Cg       G  g GC        Gc       C  a AT        Ta       C  t AT        Cg        Cg GC        Tg        Gc                         ttttctggccgaggtgaattaaagtccagaaccgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0555 ABC-type sulfate transport system, permease component ... can be seen here     ..................................................................................................................