                                                                        Gene putatively regulated by attenuation in D_radiodurans_2

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:162 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-19.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-16.40 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atatgggccggaggctgagagggcaactcgggcctaaccctatgaacctgaactggttagcaccagcggagggagtgtgacgggcgcagagacttttgtt
ctgccctcctccgtttcttcgtggggagggcttttttattgaccgacactgactgagaccgggcaggcaccgtgacttcgccgctgccttccccgacgaa
cactacagcttgaaccgaacggacgcccgaccaggcgcgctgctggcctctctttggcctgacggcgcgctccgccctcatctgttgcccggaggcctct
ATG

    DRA0175 --- DRA0174 --- DRA0173 --- DRA0172 --- DRA0171 Gene: DRA0175     GI: 15807844     BI number: DRA0175     GOG: COG0422     Description: thiamin biosynthesis ThiC Gene: DRA0174     GI: 15807843     BI number: DRA0174     GOG: COG0352     Description: thiamin-phosphate pyrophosphorylase Gene: DRA0173     GI: 15807842     BI number: DRA0173     GOG: COG2104     Description: conserved hypothetical protein Gene: DRA0172     GI: 15807841     BI number: DRA0172     GOG: COG2022     Description: thiamin biosynthesis ThiG Gene: DRA0171     GI: 15807840     BI number: DRA0171     GOG: COG0351     Description: phosphomethylpyrimidine kinas            tt           t  t            cg ag        at t  c      g  | ta        at gc        gc gc        at ta        cg cg        gc |  c      c  | a  g       gc a  g       gc g  a       gt        tc tg       c  |      t  t cg       a  |      t  t cg       g  |       gc a  a      t  |       cg a  g      g  |      |  t gt       t  |       cg tg       g  |       tg at       a  |       cg tg       g  |       cg |  a       gc        ta |  c       gc        cg cg        at        cg cg        gc        cg cg        gc        gc                         ttttttattgaccgacactgactgagaccgggcaggcaccgtgacttcgccgctgccttccccgacgaacactacagcttgaaccgaacggacgcccgaccaggcgcgctgctggcctctctttggcctgacggcgcgctccgccctcatctgttgcccggaggcctctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here [H] COG2104 Sulfur transfer protein involved in thiamine biosynthesis ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................