Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=62 nt.     Delta G=-15.83 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACCCTCTACGTCGCCCGCAACAAGGACCAGGTCGTCGCCAAGGTCAGCCTCAGCGCC
GACTACGGCAGCGGCCAACTGGTCGCGCAGGAGCCTCTGAACGGCCTGCGCTTTCCCG
CCACGCTGGCGAAGGTCGGGAACGACCTCGTGGTGACGCAGGCGCAACTGGACCGCAT
CGGCGGCACACCCGAGACGCCGTTCAAGCTCACCCGCTTCGCCAAGTTCTGAgcactctct
cttttcggcctctccccatcccgggagaggttttttcatgccccggctccgggcatactgcgcccATG

    DRA0201


Gene: DRA0201     GI: 15807867     BI number: DRA0201     GOG: COG0171     Description: NH3-dependent NAD+ synthas



 GC
C  C
 TA
 TA
 CG
 GT
C  T
C  C
C  |
 AT
 CG
 TA
 Cg
 Gc
|  a
|  c
|  t
|  c
|  t
|  c
|  t
A  c
A  t
C  t       tc
T  t      a  c
T  t      c  c
 Gc        cg
 Cg        cg
 Cg        cg
 Gc        ta
C  c       cg
 At        ta
 Gc        cg
 At        cg
 Gc        gt
            tttttcatgccccggctccgggcatactgcgcccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG0171 NAD synthase ... can be seen here

    ..................................................................................................................