                                                                        Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:1 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACCTACAAGCGCGGGACAGCGCGGGCACCAGCGCCCTCGACGCCGCCCGCACCATG
AACGCGCAGCCTTCGGTGACGTGGCTTGAAGAACGGCTGGCCCGCAGCTCGGGTTGAa
ccgccgcttcagttttctctggcccccccacatcggggggattttttatggctggcggagagcgggcggcactcctctgggcaacaaccaaccaaacgtt
cgttaggggtttacaattcgggacaagtctcaattcagattctgttgtctggtcctgctggaccgtcccggaggtgttctttccTTG

    DRA0256 Gene: DRA0256     GI: 15807919     BI number: DRA0256     GOG: COG1541     Description: phenylacetyl-CoA ligas   a g  t a  t c  c       gc t  t      t  t tg        cg at        cg at        ta cg        gc t  t       gc c  |       tg t  |      c  t gc       t  c at       g  c a  g      t  | cg       t  | at        gc gc        tg gc        cg gt        ta cg        tg             gtgttctttccTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1541 Coenzyme F390 synthetase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in D_radiodurans_2                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:166 nt.     Distance to run of Ts=2 nt.   Size=38 nt.     Delta G=-13.30 kcal/mol Antiterminator: Size=13 nt.     Delta G= -3.40 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G=-16.03 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGACCTACAAGCGCGGGACAGCGCGGGCACCAGCGCCCTCGACGCCGCCCGCACCATG AACGCGCAGCCTTCGGTGACGTGGCTTGAAGAACGGCTGGCCCGCAGCTCGGGTTGAa ccgccgcttcagttttctctggcccccccacatcggggggattttttatggctggcggagagcgggcggcactcctctgggcaacaaccaaccaaacgtt cgttaggggtttacaattcgggacaagtctcaattcagattctgttgtctggtcctgctggaccgtcccggaggtgttctttccTTG     DRA0256 Gene: DRA0256     GI: 15807919     BI number: DRA0256     GOG: COG1541     Description: phenylacetyl-CoA ligas TG G  A GC CG T  T T  | CG CG                   G GC                 A  C AT                 C  T C  |                 GC GT                  CG CG                  CG G  A                 CG C  A                 GT A  G                 GT A  A                 TG G  A                |  A T  C                |  a A  G                |  c C  |                |  c C  |                 Cg A  |        C        Gc CG       C  C       Gc GC       G  G       Cg C  T       GC       |  c CG        TA        At CG        CG        At GC        GC        Gc                         agttttctctggcccccccacatcggggggattttttatggctggcggagagcgggcggcactcctctgggcaacaaccaaccaaacgttcgttaggggtttacaattcgggacaagtctcaattcagattctgttgtctggtcctgctggaccgtcccggaggtgttctttccTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1541 Coenzyme F390 synthetase ... can be seen here     ..................................................................................................................