                                                                        Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-19.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCACAGACGACGGCCCCCACactgacgcctctcacgacgccgcaggacaccgagccgtgacggcgcgccgcctgacctaagcgt
tagggtttttgtcccgcttttgccagatgggcggcctttatcccaacatcatttgctccttcccctgccctgacccggcggggatttttctttccccaga
gaaaaatgagaaaaactcatcaaacttaccttccggtcggtaacatattgaccgagcggtaagttcgtcttacccggatcacttttcttcccctctctcg
ttcaaggagtcgtttATG

    DRA0279 Gene: DRA0279     GI: 15807941     BI number: DRA0279     GOG: COG0577     Description: hypothetical protei   c a  a at ta         c gt       t  g gt       t  t cg        gc ta        at gc        at gc        ta cg        gc c  a       gc t  g      c  | t  c      g  | cg       a  | cg        gc at        cg ta        cg ta       |  a cg        at at        gc at        ta             cttttcttcccctctctcgttcaaggagtcgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG0577 ABC-type antimicrobial peptide transport system, permease component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in D_radiodurans_2                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.10 kcal/mol Antiterminator: Size=42 nt.     Delta G= -8.17 kcal/mol Anti-antiterminator:   Size=49 nt.     Delta G=-11.36 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGCACAGACGACGGCCCCCACactgacgcctctcacgacgccgcaggacaccgagccgtgacggcgcgccgcctgacctaagcgt tagggtttttgtcccgcttttgccagatgggcggcctttatcccaacatcatttgctccttcccctgccctgacccggcggggatttttctttccccaga gaaaaatgagaaaaactcatcaaacttaccttccggtcggtaacatattgaccgagcggtaagttcgtcttacccggatcacttttcttcccctctctcg ttcaaggagtcgtttATG     DRA0279 Gene: DRA0279     GI: 15807941     BI number: DRA0279     GOG: COG0577     Description: hypothetical protei   c c  a g  g t  a t  t tg        tc tg       a  a cg       c  t gc        at cg        at cg        cg c  c      c  c t  c      c  t g  t      t  c        a t  t      a  c      g  c t  t      t  t      t  c t  a      t  t      c  c t  t      t  c       cg t  |      c  c       cg gc       c  c       gc gc        gc       t  | gc        gt        cg a  |       cg        cg ta        gc        cg ta        gc        cg gc        gc        ta                         tttttctttccccagagaaaaatgagaaaaactcatcaaacttaccttccggtcggtaacatattgaccgagcggtaagttcgtcttacccggatcacttttcttcccctctctcgttcaaggagtcgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG0577 ABC-type antimicrobial peptide transport system, permease component ... can be seen here     ..................................................................................................................