Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-15.50 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgcagatgctcgccgatgaggtgcggacccatcagaaggccggcgtgatggtcacccacgacgagcgcgtgctcgacctgtgtgaccgggtggtgacta
tggtggacgggcaactgcgcggctgacccatagagcgagttcgcctgtgaggcacgtcctgagtggcgtgcctttttcgtttgctggcatgagcgggaga
aaaggaccggctgagaacagagtgtcggcccctttacgaatgccctggcatatgccagattgggctccttacacgttcactcaaaattcaaggagaccac
ATG

    DRA0281 --- DRA0282


Gene: DRA0281     GI: 15807942     BI number: DRA0281     GOG: -------     Description: hypothetical protein
Gene: DRA0282     GI: 15807943     BI number: DRA0282     GOG: -------     Description: hypothetical protei


           gt
          a  t
           gc
           cg
           gc
          a  |
 ac        gc
a  t       at
 cg        tg
 gc        at
g  g       cg
 gc       |  a
 cg        cg
a  g       cg        ga
 gc       a  |      t  g
 gt        gc       c  t
|  g       ta        cg
|  a      |  c       tg
t  c       cg        gc
 gc        gt        cg
 gc        gc        at
 ta       c  c       cg
 at        gt        gc
 ta        cg        gc
                        tttttcgtttgctggcatgagcgggagaaaaggaccggctgagaacagagtgtcggcccctttacgaatgccctggcatatgccagattgggctccttacacgttcactcaaaattcaaggagaccacATG


    ..................................................................................................................