                                                                        Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions

ACACCGCGCAACTCGTAGACGAAGATGTCAAGCGCATCCTCGCCGCCGCTTACGAGCG
CTCGCGCCAGATCGTCTCCGACTACAAGCAGGCGATGCAGGAAGTGGCCGACGCCCTG
CTCACCCACGAACTCATCACCGGCGACGTGGTGCGCGACGCCGTGGCGCGGGTGGGCG
GCCAGTCGGTGGCCGTGGCGCCTGCTCCGACCGTCTAAccgcttctttcccgaatggcccctcccctgcgga
ggggttttttgtgcttgcttcgcgggcaagcccccgaccgcctatgctcgggccATG

    DRA0291 --- DRA0292 --- DRA0293 --- DRA0294 Gene: DRA0291     GI: 15807951     BI number: DRA0291     GOG: COG3836     Description: 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase Gene: DRA0292     GI: 15807952     BI number: DRA0292     GOG: -------     Description: hypothetical protein Gene: DRA0293     GI: 15807953     BI number: DRA0293     GOG: COG2373     Description: hypothetical protein Gene: DRA0294     GI: 15807954     BI number: DRA0294     GOG: -------     Description: hypothetical protei            t          c  g          c  c           cg           cg           ta           cg           cg           cg           cg           gt           gt             ttttgtgcttgcttcgcgggcaagcccccgaccgcctatgctcgggccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3836 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase ... can be seen here [R] COG2373 Large extracellular alpha-helical protein ... can be seen here     ..................................................................................................................