Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAGCCGCCGCCCGCAACGCCGAGGAGTACCGCGCGGCCCTGAAAACCGCCGCCGCTG
CGCTGGAGGAATACCAGGGCGTGACCACCCGCCAACTGTCCGAAGTGCTGCGGCACGG
CCTGCGCGAGAGCTGAgtcaagaaaagcaaaggcgtctgggagtccttttcaggcgccgtttttcatgctgctatctctttgagtaaa
gactccatgaagatgtttccgtaagctttctcaggcgttgcacaggaaggatgaacgagccaaagcgggccccccttctggcaaaggagtctttccATG


    DRA0345 --- DRA0344


Gene: DRA0345     GI: 15808004     BI number: DRA0345     GOG: COG2312     Description: hypothetical protein
Gene: DRA0344     GI: 15808003     BI number: DRA0344     GOG: COG1974     Description: lexA represso


 aa
a  g
 cg
 gc         c
a  g      t  c
a  |       gt
a  |       at
 at       g  t
 gc       g  t
 at        gc
|  g       ta
a  g       cg
 cg        tg
 ta        gc
g  g       cg
 At        gc
 Gc        gc
            gtttttcatgctgctatctctttgagtaaagactccatgaagatgtttccgtaagctttctcaggcgttgcacaggaaggatgaacgagccaaagcgggccccccttctggcaaaggagtctttccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG2312 Erythromycin esterase homolog ... can be seen here
[KT] COG1974 SOS-response transcriptional repressors (RecA-mediated autopeptidases) ... can be seen here

    ..................................................................................................................