                                                                        Gene putatively regulated by attenuation in D_radiodurans_2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-16.30 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-23.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCGGTCAGCCGCGCCTCATGGCGCAGGTGGTGCAGCCCCAGCCCCCAGCGCCCCTGC
GCTTCTTGCAAGGACTGCGTGAGCGCCGCGTCCAGCGTGCCCGCGTCGGCCTCACTCG
CGGCGAGGGCGGCGATCTGGCTGTCCACGCCCGCCGTGCTCATCAAGGTGTCGAAGGC
GGCGTAGATGCCGTCCGTTTGGTCTTTTGCTTTAGCCCTTGCCATACTGCCTTTATTA
TGCCCTGAACAGATTAAAAAGGCCAGGGGTAGCACtctggcataaggaaaacccagcttcggcggtctTTG

    DRA0347 Gene: DRA0347     GI: 15808006     BI number: DRA0347     GOG: COG0491     Description: hypothetical protei TC A  T       AA G  G      C  G CG        TG GC        AT GT        CG CG       T  T GT       C  C       AG GC       G  G      T  A GC       T  A       GT A  A      G  A       CG GC        CG        GC CG        CG        GC |  C       GC        CG GC       C  |      |  T GC        CG        GC CG        CG        GC GC        GC       |  G C  C       CG        AT T  |       AT        AT CG       C  A       GT AT        CG        CG CG        TA        TG                         TCTTTTGCTTTAGCCCTTGCCATACTGCCTTTATTATGCCCTGAACAGATTAAAAAGGCCAGGGGTAGCACtctggcataaggaaaacccagcttcggcggtctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here     ..................................................................................................................