                                                                        Gene putatively regulated by attenuation in D_psychrophila_LSv54_l1

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=1 nt.   Size=19 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gttgtgactgtcttgatttaggtatatgttgtaagcagttacatgctactaactggtagcatgttaaatgattaattctcagggcggggtggaattcccc
accggcggtgattccctgtggggacagcccgcgagcgcctgtcattatggcagggtccagctgatctggtgagattccagagccgacggttagagtccgg
aaggaagagataaggcggtaatccgtagtggtgctttctgtgccatgttctttaatgctcctccatgccctgattctggtaaataaaaggagaaattacc
ATG

    DP0701 Gene: DP0701     GI: 51244553     BI number: DP0701     GOG: -------     Description: probable 3,4-dihydroxy-2-butanone 4-phosphate synthas ga g  a cg cg        aa ta       t  t g  a       gc a  g       gc g  a       cg a  |       gt tg       g  a ta       a  g        t gt        at       t  c |  a       tg       t  t g  a      |  g       cg c  g      |  t       gt a  g      a  g       tg gc        gc        gc cg        at        gc cg        gt        ta gt        at        gt                         gttctttaatgctcctccatgccctgattctggtaaataaaaggagaaattaccATG                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................