                                                                        Gene putatively regulated by attenuation in D_vulgaris_Hildenborough_l1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-26.60 kcal/mol
Antiterminator: Size=73 nt.     Delta G=-40.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCACGTACTTCCCCACTTCCGGTGCCAGCTATTACTGGTACTTTTTTAGCTATGGAGA
AGCCCGTGGCCTGGTGGGTCGCGCCTAGacctcattaaaggatcaggtgcaccgagacaacaggggccgcgggcgaaag
ccagcggcccttttcttgtatccggcgtcggagcgcgcactgccgccggaaaggaacgaggggacgcccgaacgttccatcagcaggggatgacacatgc
ggcggaaccgccaatgaacgggcgcagcgcgccgcaacaatgcttcatgacgaggatggcatcATG

    DVU0460 --- DVU0461 --- DVU0462 --- aroA --- DVU0464 Gene: DVU0460     GI: 46578876     BI number: DVU0460     GOG: COG1830     Description: predicted phospho-2-dehydro-3-deoxyheptonate aldolase Gene: DVU0461     GI: 46578877     BI number: DVU0461     GOG: COG1465     Description: predicted 3-dehydroquinate synthase Gene: DVU0462     GI: 46578878     BI number: DVU0462     GOG: COG0077,COG1605     Description: chorismate mutase/prephenate dehydratase Gene: aroA     GI: 46578879     BI number: DVU0463     GOG: COG0128     Description: 3-phosphoshikimate 1-carboxyvinyltransferase Gene: DVU0464     GI: 46578880     BI number: DVU0464     GOG: COG0287,COG4937     Description: prephenate dehydrogenas tt a  a c  a ta cg cg |  a at Gc A  | Ta Cg Cg Gt Cg Gc C  | Ta Gc Gc |  g |  a |  g |  a |  c G  a Ta Gc        aa |  a      g  a G  g       cg Tg        gc Cg        gc Cg       g  a Gc        cg Gc        gc Tg        cg Gc        cg Cg        gc Cg        gc Cg        gc Gc        gt             tttcttgtatccggcgtcggagcgcgcactgccgccggaaaggaacgaggggacgcccgaacgttccatcagcaggggatgacacatgcggcggaaccgccaatgaacgggcgcagcgcgccgcaacaatgcttcatgacgaggatggcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1830 DhnA-type fructose-1,6-bisphosphate aldolase and related enzymes ... can be seen here [E] COG1465 Predicted alternative 3-dehydroquinate synthase ... can be seen here [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here [E] COG0287 Prephenate dehydrogenase ... can be seen here [J] COG4937 Predicted regulatory domain of prephenate dehydrogenase ... can be seen here     ..................................................................................................................