                                                                        Gene putatively regulated by attenuation in D_vulgaris_Hildenborough_l1

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-14.10 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cggatgggcttttttgtttttcgagtatcagcggtcgccgtcgcgaccggagctaggggagccttcgggctgagagtgggttcgtcccagaccctgtgaa
cctgacgcagttagcactgccgtagggaagccgcgcaccggacatgcgtccgtacgcccatcctctgcggatgggcgttctgtttttccggcgcccgccg
catcgcctttgcgccctgcctgcgactatggcggcagggcaggcggggcggtcggccttggcaggcgtcagcagacaacccggcagaaggagagacggcg
ATG

    thiG --- thiH --- DVU2092 --- 1 Gene: thiS     GI: 46580500     BI number: DVU2095     GOG: -------     Description: thiamine biosynthesis protein ThiS Gene: thiG     GI: 46580499     BI number: DVU2094     GOG: COG2022     Description: thiG protein Gene: thiH     GI: 46580498     BI number: DVU2093     GOG: COG1060     Description: thiH protein Gene: DVU2092     GI: 46580497     BI number: DVU2092     GOG: -------     Description: thiF family protei            tg           a  c            cg            at aa        gc g  g       gc gc        cg gc       c  t |  g      a  a |  c      c  | |  g       gc |  c       cg         t a  a       gc       c  g t  c      c  c      t  c gc       c  c       cg cg       g  a       cg cg       a  |       ta |  a       at        at gc        gc        cg ta        gc        cg c  |      |  t       cg at        gc        gc cg        at        cg gc        tg        at                         tctgtttttccggcgcccgccgcatcgcctttgcgccctgcctgcgactatggcggcagggcaggcggggcggtcggccttggcaggcgtcagcagacaacccggcagaaggagagacggcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [HR] COG1060 Thiamine biosynthesis enzyme ThiH and related uncharacterized enzymes ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................