                                                                        Gene putatively regulated by attenuation in E_faecalis_V583

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

caacaacgaagaaaaaccatacacaactgaataacttttactttagctattttagataggtttgtattcataacattatgggtacagacaacaaacgttt
gtatctataatggctagggaaatttaagatgactttcagccatgtagatttaagaaaatctatagtggcttttatattgcttttttgtagggtattcact
gtagatttttcttaaaatttactgtgaatatcctttttgtttggccaaaaattaggatttcagaaacttactaaaaaaatttcgtaaaggagcacacagg
ATG

    aroE --- EF1562 --- aroB --- aroC --- EF1565 --- aroA --- aroK --- EF1568 Gene: aroE     GI: 29376124     BI number: EF1561     GOG: COG0169     Description: shikimate 5-dehydrogenase Gene: EF1562     GI: 29376125     BI number: EF1562     GOG: COG2876     Description: phospho-2-dehydro-3-deoxyheptonate aldolase, putative Gene: aroB     GI: 29376126     BI number: EF1563     GOG: COG0337     Description: 3-dehydroquinate synthase Gene: aroC     GI: 29376127     BI number: EF1564     GOG: COG0082     Description: chorismate synthase Gene: EF1565     GI: 29376128     BI number: EF1565     GOG: COG0287     Description: prephenate dehydrogenase Gene: aroA     GI: 29376129     BI number: EF1566     GOG: COG0128     Description: 3-phosphoshikimate 1-carboxyvinyltransferase Gene: aroK     GI: 29376130     BI number: EF1567     GOG: COG0703     Description: shikimate kinase Gene: EF1568     GI: 29376131     BI number: EF1568     GOG: COG0077     Description: prephenate dehydratas   a c  a a  a        a a  c      t  a cg        tg        ag at        ta       a  a gt        at        ta at       a  g       ta cg       a  a       ta at        gc        at ta        gt        gc gt        gt        at gc        at        ta gt       |  c       gt ta        ta        ta at        cg       |  g ta        gc        at ta        gc        cg at        ta        cg cg        at        gc                         ttttatattgcttttttgtagggtattcactgtagatttttcttaaaatttactgtgaatatcctttttgtttggccaaaaattaggatttcagaaacttactaaaaaaatttcgtaaaggagcacacaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0169 Shikimate 5-dehydrogenase ... can be seen here [E] COG2876 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase ... can be seen here [E] COG0337 3-dehydroquinate synthetase ... can be seen here [E] COG0082 Chorismate synthase ... can be seen here [E] COG0287 Prephenate dehydrogenase ... can be seen here [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here [E] COG0703 Shikimate kinase ... can be seen here [E] COG0077 Prephenate dehydratase ... can be seen here     ..................................................................................................................