                                                                        Gene putatively regulated by attenuation in E_faecalis_V583

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=77 nt.     Delta G=-19.91 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

acagacctacctactgtatggtggatgaaaccaataagaccacagattattctggaaggattgggagtaagaagaagctaagtcaggataccggcttgat
aagtctaatcattcttttgtaggaaaaagaaggggctttgaagataactggctgagtatatcattagcatagttaagtgactgctttttttctattggag
aaaaaagtggtttttttgtattgttttgacgttgagacaaaggaggttcatttcagaaaattttccccaaaataaaatagacgaatgcgaggatgaaaaa
ATG

    EF1641 --- EF1640 --- EF1639 Gene: EF1641     GI: 29376196     BI number: EF1641     GOG: COG0614     Description: iron compound ABC transporter, iron compound-binding protein Gene: EF1640     GI: 29376195     BI number: EF1640     GOG: COG0609     Description: iron compound ABC transporter, permease protein Gene: EF1639     GI: 29376194     BI number: EF1639     GOG: COG1120     Description: iron compound ABC transporter, ATP-binding protei            ta           a  t           t  c           g  a            at            gt            ta            cg            gc           |  a            gt            ta            cg            at            at            ta           a  |           g  |           a  |           a  |           g  |           t  | ag       t  | t  g       ta g  a       cg ta        gt ta       g  g       tt ta       g  a      a  g ta        gc       t  g cg        at       c  a ta       |  g       tg ta       a  c       ta a  g       gt        ta c  |       at        ta t  |       at        ta a  |       at        ta a  |       at        ta tg        at        cg cg        gt       g  t tg        gc       t  g gc        at        cg at        ta        at at        gt        gt                         tttttgtattgttttgacgttgagacaaaggaggttcatttcagaaaattttccccaaaataaaatagacgaatgcgaggatgaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................