                                                                        Gene putatively regulated by attenuation in E_faecalis_V583

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:114 nt.    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-17.30 kcal/mol
Antiterminator:    Distance from promoter:83 nt. Size=46 nt.     Delta G= -4.04 kcal/mol
Anti-antiterminator:    Distance from promoter:49 nt.    Size=51 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tagttt-tatagt. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tagtttttataattattctatgctatagtaaaagtacattttaataaaaaacatttggggtgctgttatggctgagatgatacccattgaacctgatgca
gttagtactgtcgcagggaaatgccgatttactttgatttttcacgcactcattctgtcctaggatgagtgtgttttcttttatcagggtttatttaagt
cactccttttgctttttgttaagagaaaggagtttttttaTTG

    EF2770 --- EF2769 --- EF2768 --- EF2767 Gene: EF2770     GI: 29377244     BI number: EF2770     GOG: COG4721     Description: conserved hypothetical protein Gene: EF2769     GI: 29377243     BI number: EF2769     GOG: COG1122     Description: ABC transporter, ATP-binding protein Gene: EF2768     GI: 29377242     BI number: EF2768     GOG: NOG43480     Description: conserved hypothetical protein Gene: EF2767     GI: 29377241     BI number: EF2767     GOG: COG0819     Description: transcriptional regulato ag t  t ta        tt gc       t  g at       c  a cg       a  t gt       t  t t  c      t  t a  g      t  t gc        at ta        gc         c cg       |  a      t  c cg       c  c       gt a  g       cg        ta a  a       gc        cg g  |       ta        tg ta       |  c       ta ta       a  t       at at       a  c       cg cg       a  a       ta c  c       gt        cg c  c       gt        at a  g       gc        cg ta        at        gt at        cg        cg gt        gt        at                         tttcttttatcagggtttatttaagtcactccttttgctttttgttaagagaaaggagtttttttaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4721 Predicted membrane protein ... can be seen here [P] COG1122 ABC-type cobalt transport system, ATPase component ... can be seen here [K] COG0819 Putative transcription activator ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in E_faecalis_V583 This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:117 nt.    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.70 kcal/mol Antiterminator:    Distance from promoter:82 nt. Size=46 nt.     Delta G= -4.04 kcal/mol Anti-antiterminator:    Distance from promoter:49 nt.    Size=51 nt.     Delta G=-13.80 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tagttt-tatagt. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tagtttttataattattctatgctatagtaaaagtacattttaataaaaaacatttggggtgctgttatggctgagatgatacccattgaacctgatgca gttagtactgtcgcagggaaatgccgatttactttgatttttcacgcactcattctgtcctaggatgagtgtgttttcttttatcagggtttatttaagt cactccttttgctttttgttaagagaaaggagtttttttaTTG     EF2770 --- EF2769 --- EF2768 --- EF2767 Gene: EF2770     GI: 29377244     BI number: EF2770     GOG: COG4721     Description: conserved hypothetical protein Gene: EF2769     GI: 29377243     BI number: EF2769     GOG: COG1122     Description: ABC transporter, ATP-binding protein Gene: EF2768     GI: 29377242     BI number: EF2768     GOG: NOG43480     Description: conserved hypothetical protein Gene: EF2767     GI: 29377241     BI number: EF2767     GOG: COG0819     Description: transcriptional regulato ag t  t ta        tt gc       c  t at       a  g cg       t  a gt       t  t t  c      t  t a  g      a  t gc        gt ta        ct cg       |  c cg       c  a a  g       gc         c a  a       tg       t  c g  |       ac        gt ta       |  a       ta ta       a  c       cg at       a  t       tg cg       g  c       ta c  c       ga        at c  c       gt        cg a  g       at        ta ta        cc        cg at        gt        at gt        cg        cg                         tgttttcttttatcagggtttatttaagtcactccttttgctttttgttaagagaaaggagtttttttaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4721 Predicted membrane protein ... can be seen here [P] COG1122 ABC-type cobalt transport system, ATPase component ... can be seen here [K] COG0819 Putative transcription activator ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................