                                                                        Gene putatively regulated by attenuation in E_faecalis_V583

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:165 nt.    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-10.20 kcal/mol
Antiterminator:    Distance from promoter:134 nt. Size=35 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:    Distance from promoter:101 nt.    Size=50 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tagtcg-tatact. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tagtcgcttccaaaaaactatgctatactaaagccaattgaagagaaacatttggggtgctattagctgagattatacccatggaacctgaaacagttag
gactggcgcagggaaatgtcttgaaattttgaccgattattgcacccaactacgtttatttgtggttgggtttttctgtctttttcagtcgcgcctcctt
ttgcttctcgcagaaaggagtttttttacGTG

    EF2778 --- EF2777 --- thiE --- thiD Gene: EF2778     GI: 29377251     BI number: EF2778     GOG: COG4732     Description: conserved hypothetical protein Gene: EF2777     GI: 29377250     BI number: EF2777     GOG: COG2145     Description: hydroxyethylthiazole kinase, putative Gene: thiE     GI: 29377249     BI number: EF2776     GOG: COG0352     Description: thiamine-phosphate pyrophosphorylase Gene: thiD     GI: 29377248     BI number: EF2775     GOG: COG0351     Description: phosphomethylpyrimidine kinas ta t  t t  t gt cg at tg cg at         t at       t  t cg       c  t cg       t  t cg        gc at        ta         c c  t       cg       t  t g  t      t  t      t  c t  t      t  c       cg t  |      t  g       gc a  |      t  c       ta t  |       tg        tg t  |       gc       |  a at        gc        ta gc        gt        ta c  t      t  |       cg cg       t  |       cg at        gc        ta gc        gc        cg                         tttttttacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4732 Predicted membrane protein ... can be seen here [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in E_faecalis_V583 This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:114 nt.    Distance to gene:45 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tagtcg-tatact. It has a score value of 68.27 and is shown in blue tagtcgcttccaaaaaactatgctatactaaagccaattgaagagaaacatttggggtgctattagctgagattatacccatggaacctgaaacagttag gactggcgcagggaaatgtcttgaaattttgaccgattattgcacccaactacgtttatttgtggttgggtttttctgtctttttcagtcgcgcctcctt ttgcttctcgcagaaaggagtttttttacGTG     EF2778 --- EF2777 --- thiE --- thiD Gene: EF2778     GI: 29377251     BI number: EF2778     GOG: COG4732     Description: conserved hypothetical protein Gene: EF2777     GI: 29377250     BI number: EF2777     GOG: COG2145     Description: hydroxyethylthiazole kinase, putative Gene: thiE     GI: 29377249     BI number: EF2776     GOG: COG0352     Description: thiamine-phosphate pyrophosphorylase Gene: thiD     GI: 29377248     BI number: EF2775     GOG: COG0351     Description: phosphomethylpyrimidine kinas           ta          t  t          t  t           gt           cg           at           tg           cg           at           at           cg           cg           cg           at             ttttctgtctttttcagtcgcgcctccttttgcttctcgcagaaaggagtttttttacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4732 Predicted membrane protein ... can be seen here [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in E_faecalis_V583 This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:114 nt.    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tagtcg-tatact. It has a score value of 68.27 and is shown in blue tagtcgcttccaaaaaactatgctatactaaagccaattgaagagaaacatttggggtgctattagctgagattatacccatggaacctgaaacagttag gactggcgcagggaaatgtcttgaaattttgaccgattattgcacccaactacgtttatttgtggttgggtttttctgtctttttcagtcgcgcctcctt ttgcttctcgcagaaaggagtttttttacGTG     EF2778 --- EF2777 --- thiE --- thiD Gene: EF2778     GI: 29377251     BI number: EF2778     GOG: COG4732     Description: conserved hypothetical protein Gene: EF2777     GI: 29377250     BI number: EF2777     GOG: COG2145     Description: hydroxyethylthiazole kinase, putative Gene: thiE     GI: 29377249     BI number: EF2776     GOG: COG0352     Description: thiamine-phosphate pyrophosphorylase Gene: thiD     GI: 29377248     BI number: EF2775     GOG: COG0351     Description: phosphomethylpyrimidine kinas           ta          t  t          t  t           gt           cg           at           tg           cg           at           at           cg           cg           cg           at             ttttctgtctttttcagtcgcgcctccttttgcttctcgcagaaaggagtttttttacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4732 Predicted membrane protein ... can be seen here [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................