                                                                        Gene putatively regulated by attenuation in E_carotovora_atroseptica_SCRI1043

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=3 nt.   Size=20 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -5.96 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCGCCTTTATCGACTGGTGTACCGCGCTAATCGAGAAGGAATCCGTGAAATGGTGA
atgtccacaaacagaacaaccaaggtcattacgttaaacgaaattgtgcacgtactgcggctgcggctgaatgagcattcaaatctggttcgcgccgccg
gaacacggagagcctttcactgtccgacttaaccctttacaatgagcCGTTCTCAACGGGGTGCGGAAAATTTTTCGC
TGAGAAGATACCCGTCGAACCTGATCCGGTTAATACCGGCGAAGGGATTTGAGAGTGC
GGCTTATTG

    tbpA --- thiP --- thiQ Gene: tbpA     GI: 50122765     BI number: ECA3844     GOG: COG4143     Description: thiamine-binding periplasmic protein precursor Gene: thiP     GI: 50122766     BI number: ECA3845     GOG: COG1178     Description: thiamine transport system permease protein Gene: thiQ     GI: 50122767     BI number: ECA3846     GOG: COG3840     Description: thiamine transport ATP-binding protei             a           t  a           t  c           c  c           a  c           g  t           c  t           c  t            ta            gc            ta           c  a   t        at t  t       cg        AC c  c       ta       A  G c  a       tg        CG gc       t  c       TG at       c  C       CG g  g       cG       T  T at        gT        TG gc        aT        GC gc        gC        CG cg        aT        cG                         AAAATTTTTCGCTGAGAAGATACCCGTCGAACCTGATCCGGTTAATACCGGCGAAGGGATTTGAGAGTGCGGCTTATTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG4143 ABC-type thiamine transport system, periplasmic component ... can be seen here [P] COG1178 ABC-type Fe3+ transport system, permease component ... can be seen here [H] COG3840 ABC-type thiamine transport system, ATPase component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................