Gene putatively regulated by attenuation in E_coli_CFT073

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:119 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.60 kcal/mol
Antiterminator:    Distance from promoter:74 nt. Size=56 nt.     Delta G=-21.90 kcal/mol
Anti-antiterminator:    Distance from promoter:46 nt.    Size=51 nt.     Delta G=-14.44 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACA-TACTGT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACAGCGTGAAAACAGTACGGGTACTGTACTAAAGTCACTTAAGGAAACAAACATG
AAACACACACCGTTTTTCTTCGCATTCTTTTTTACCTTCCCCTGAatgggaggcgtttcgtcgtgtg
aaacagaatgcgaagacgaacaataaggcctcccaaatcggggggccttttttattgataacaaaaaggcaacactATG

    pheA


Gene: pheA     GI: 26248962     BI number: c3120     GOG: COG0077,COG1605     Description: P-protei


           ac
          a  a
          a  g
          g  a
           ta
 GA        gt
T  a       tg
C  t       gc
 Cg       |  g
 Cg       |  a
 Cg       |  a
 Ta        cg
 Tg        ta
 Cg        gc
|  c       cg
 Cg        ta
 At       |  a
T  t      |  c
T  t      |  a
T  c      |  a        a
T  g      |  t      a  t
T  t       ta       a  c
T  c       ta        cg
C  |      g  g       cg
T  |       cg        cg
 Tg        gc        tg
 At        gc        cg
 Cg        at        cg
 Gt        gc        gc
 Cg        gc        gc
 Ta        gc        at
 Ta        ta        at
                        ttttattgataacaaaaaggcaacactATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0077 Prephenate dehydratase ... can be seen here
[E] COG1605 Chorismate mutase ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in E_coli_CFT073

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:201 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions

GCAACATCGGTGAAAGACGCCAACTTCGTCGAAGAAGTTGAAGAAGAGTAGTCCTTTA
TATTGAGTGTATCGCCAACGCGCCTTCGGGCGCGTTTTTTGTTGACAGCGTGAAAACA
GTACGGGTACTGTACTAAAGTCACTTAAGGAAACAAACATGAAACACACACCGTTTTT
CTTCGCATTCTTTTTTACCTTCCCCTGAatgggaggcgtttcgtcgtgtgaaacagaatgcgaagacgaacaataaggc
ctcccaaatcggggggccttttttattgataacaaaaaggcaacactATG

    pheA


Gene: pheA     GI: 26248962     BI number: c3120     GOG: COG0077,COG1605     Description: P-protei


          TC
         T  G
          CG
          CG
          GC
          CG
          GC
          CG
          AT
          AT
            TTTTGTTGACAGCGTGAAAACAGTACGGGTACTGTACTAAAGTCACTTAAGGAAACAAACATGAAACACACACCGTTTTTCTTCGCATTCTTTTTTACCTTCCCCTGAatgggaggcgtttcgtcgtgtgaaacagaatgcgaagacgaacaataaggcctcccaaatcggggggccttttttattgataacaaaaaggcaacactATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0077 Prephenate dehydratase ... can be seen here
[E] COG1605 Chorismate mutase ... can be seen here

    ..................................................................................................................