                                                                        Gene putatively regulated by attenuation in E_coli_K12

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:177 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.60 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCGGCACCATGTGGAAGCTGCCAGTCACTTCCTAACACGCAATTCTTATCGATCGTT
CCTTGTGGAGCGTTAAGCATCAACAAACGGCTAAGGGCATCCATatcagactcctgagtggtttttg
attacaaacaccaacaatcttagtaaataactaatctaataccatcaaatagttaatcatgatttttgttttgtgattctgattaagaaaaagaaaatat
cagacgataagacaaaatatcaagcgttgtgaagaaatgttatttgctcttttgcgtctatagtcatgatgtcaaATG

    ykgC Gene: ykgC     GI: 16128289     BI number: b0304     GOG: COG1249     Description: putative oxidoreductas             C           A  A           A  A           C  A           T  C TG       A  G T  T       CG CG        GC CG        AT TA       A  A TG        TA GC        TG        ct CG       G  G      a  c T  T       CG        gc A  |       GC        at G  |      |  A       cg C  |       AT        ta T  |       GC       a  | AT        GC        Tg TA        TA        At TA        GT        Cg CG        Ta        Cg                         tttttgattacaaacaccaacaatcttagtaaataactaatctaataccatcaaatagttaatcatgatttttgttttgtgattctgattaagaaaaagaaaatatcagacgataagacaaaatatcaagcgttgtgaagaaatgttatttgctcttttgcgtctatagtcatgatgtcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1249 Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide dehydrogenase (E3) component, and related enzymes ... can be seen here     ..................................................................................................................