                                                                        Gene putatively regulated by attenuation in F_nucleatum

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:122 nt.    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-13.50 kcal/mol
Antiterminator:    Distance from promoter:92 nt. Size=46 nt.     Delta G=-10.86 kcal/mol
Anti-antiterminator:    Distance from promoter:56 nt.    Size=51 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taaaat. It has a score value of 83 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaaatagaataaaaaattttaaaatagaaaagtaaaatacaataatatatgtactggggagctttgtgctgagattagaaccttttttcttagacc
catagtacctgatttggataatgccaacgaagggagtaccatcttaataataactttctttggagcaatcctaagaaagttttttattttagaaaagagg
aaatatgaaaaactttattagtaaacatataagttttattagcattataattTTG

    FN0237 --- FN0236 --- FN0235 Gene: FN0237     GI: 19703582     BI number: FN0237     GOG: COG0600     Description: ABC transporter permease protein Gene: FN0236     GI: 19703581     BI number: FN0236     GOG: COG0715     Description: ABC transporter substrate-binding protein Gene: FN0235     GI: 19703580     BI number: FN0235     GOG: COG1116     Description: ABC transporter ATP-binding protei at g  t t  t cg         t cg       t  a a  |      c  a ta       t  t gt       a  a a  a      c  a ta       c  t at       a  a cg        ta c  c       gc        ca c  c       at       g  a a  a      g  t       at g  a      g  t       gc a  c       gc        gc t  |       at       t  t t  |       at        ta cg        gt        ta ta        cg        cg ta       a  g       ta tg       a  a       ta tg       c  |       ta tg        cg        cg ta        gc        at cg        ta        at                         ttttattttagaaaagaggaaatatgaaaaactttattagtaaacatataagttttattagcattataattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [P] COG1116 ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................