                                                                        Gene putatively regulated by attenuation in F_nucleatum

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccttattttttaaggctaagagggaatttggtgagataccaaaacgagcccgtcgctgtaattgagttttttcttgttttataccactggatttttattt
gggaaggtaaagaaatataaatcataagtcagaagacctgcataattgaattactctatctcgtggaaaagataaagagtaaaactcttagtgtgtaata
gctatgcttttttacgatgcatggcttttttattttaaatcagtacaaggaggaatattttatgaaaaaatctataaaaaaatttatattatttctgttt
TTG

    FN0300 --- FN0301 --- FN0302 --- FN0303 Gene: FN0300     GI: 19703645     BI number: FN0300     GOG: COG0614     Description: Iron(III) dicitrate-binding protein Gene: FN0301     GI: 19703646     BI number: FN0301     GOG: COG0609     Description: Iron(III) dicitrate transport system permease protein fecD Gene: FN0302     GI: 19703647     BI number: FN0302     GOG: COG1120     Description: Iron(III) dicitrate transport ATP-binding protein fecE Gene: FN0303     GI: 19703648     BI number: FN0303     GOG: COG1348     Description: Nitrogenase iron protei             a           a  a           t  a            gc            at            gc            at            at gg       |  a t  a      |  g g  a      |  t c  a      |  g        t ta        at       t  a cg        tg       t  c ta        at       t  g at       g  a      t  a |  a      a  a      t  t |  a      a  t       cg ta       a  a       gc cg       a  g       ta ta        gc        at cg        gt        tg at        ta        cg ta        gt        gc ta        cg        at                         tttttattttaaatcagtacaaggaggaatattttatgaaaaaatctataaaaaaatttatattatttctgtttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here [P] COG1348 Nitrogenase subunit NifH (ATPase) ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................