                                                                        Gene putatively regulated by attenuation in F_nucleatum

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:165 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-10.00 kcal/mol
Antiterminator:    Distance from promoter:118 nt. Size=60 nt.     Delta G=-14.70 kcal/mol
Anti-antiterminator:    Distance from promoter:91 nt.    Size=56 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tatatt. It has a score value of 92.37 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaaattaataaaagaatattatattaatgatgtaaataatcgaatatgtaaaataaagtcttcagggcagggtgaaattcccgaccggtggtacag
tccacgaaagcatttgctttgatttggtgaaattccaaaaccgacagtagagtctggatgggagaagaattagattttttaattatactcatattgctca
gactttgtttgagcatttttttattaaaacaaaaattttaaatatatTTG

    FN1505 --- FN1506 Gene: FN1505     GI: 19704837     BI number: FN1505     GOG: COG0054     Description: 6,7-dimethyl-8-ribityllumazine synthase Gene: FN1506     GI: 19704838     BI number: FN1506     GOG: COG0117,COG1985     Description: Diaminohydroxyphosphoribosylaminopyrimidine deaminas             t           t  t ta        at g  g       gt a  a       at cg        ta at        ta gc        at |  t       at cg       g  a cg       a  t a  a      a  a a  |       gc a  |       at at        gc cg       g  a cg        gt tg        ta ta        at |  g       gt a  a      |  g a  a      |  c        t a  g      |  t      t  t g  a       gc        cg ta        ta        at gt        cg        gt gt        ta        at ta        gc        cg tg        at        ta ta        gt        cg at        at        gc gt        tg        ta                         tttttttattaaaacaaaaattttaaatatatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0054 Riboflavin synthase beta-chain ... can be seen here [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................