                                                                        Gene putatively regulated by attenuation in G_sulfurreducens

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-13.50 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-14.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gaaaaggcttgacgaaaatggggagaattgctagctttgtctgagcgttagactgtttcgacaatcacataccatcgaaccgctaggggagtttcggctg
agagcccgtctgtgatgccgttcggaccgcgcccggataacagggaataacgcggcacggagcggcagggcgacccttcgaacctgatccgggtaatacc
ggcgtagggaagcgatagaacatggatcaccacaacccatgggccgcttctgcggccttttttgtttacacaaccccaccgtatcccgacaggaggcccc
ATG

    GSU0589 Gene: GSU0589     GI: 39995696     BI number: GSU0589     GOG: COG2104     Description: conserved hypothetical protei aa t  t g  a        c gc       c  a gc       a  c cg       c  a cg       t  a t  |      a  c a  |       gc g  |       gc t  |       ta c  |       at c  |       cg a  |      a  g a  |      a  g gc       g  c cg       a  | t  t      t  |       tc ta       a  |      t  t cg        gc        cg cg        cg        gc cg        gc        cg a  a       at        cg g  a       at        gc cg        gc        gc gc        gt        gt                         tttttgtttacacaaccccaccgtatcccgacaggaggccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2104 Sulfur transfer protein involved in thiamine biosynthesis ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................